ID: 1088821037_1088821044

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1088821037 1088821044
Species Human (GRCh38) Human (GRCh38)
Location 11:113457690-113457712 11:113457730-113457752
Sequence CCCCTGAGCTCTGTCCGCACAGC AGTATCTAATTTGGAAATTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 197} {0: 1, 1: 0, 2: 3, 3: 30, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!