ID: 1088849515_1088849522

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1088849515 1088849522
Species Human (GRCh38) Human (GRCh38)
Location 11:113693528-113693550 11:113693563-113693585
Sequence CCCTCCAAGTTTTATAACAAACA TGTGTTGGAAAAACTTCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 295} {0: 1, 1: 0, 2: 1, 3: 18, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!