ID: 1089257334_1089257343

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1089257334 1089257343
Species Human (GRCh38) Human (GRCh38)
Location 11:117200793-117200815 11:117200839-117200861
Sequence CCTGAGACTGGAAGCTGGGGGTA TGTTCCTCAGGAGCCCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 262} {0: 1, 1: 0, 2: 2, 3: 27, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!