ID: 1089262535_1089262541

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1089262535 1089262541
Species Human (GRCh38) Human (GRCh38)
Location 11:117232627-117232649 11:117232643-117232665
Sequence CCGCTCGTGCCGCCGGAAGTGGG AAGTGGGAGGTGCCGCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41} {0: 1, 1: 0, 2: 0, 3: 11, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!