ID: 1089281178_1089281184

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1089281178 1089281184
Species Human (GRCh38) Human (GRCh38)
Location 11:117375704-117375726 11:117375752-117375774
Sequence CCAGGACTTCGGTTTTCGCAGCC TGATGTGCTTTCCCCAGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51} {0: 1, 1: 0, 2: 0, 3: 23, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!