ID: 1089325668_1089325680

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1089325668 1089325680
Species Human (GRCh38) Human (GRCh38)
Location 11:117655142-117655164 11:117655166-117655188
Sequence CCAGCTGCCATCTCCATGCCCTG TATTGGGGGCTTTCTGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 51, 4: 527} {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!