ID: 1089337856_1089337866

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1089337856 1089337866
Species Human (GRCh38) Human (GRCh38)
Location 11:117737468-117737490 11:117737505-117737527
Sequence CCCAAAGGGGATCGTGGCATAAT GGACAGCAGGACAGCGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58} {0: 1, 1: 0, 2: 4, 3: 42, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!