ID: 1089338115_1089338116

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1089338115 1089338116
Species Human (GRCh38) Human (GRCh38)
Location 11:117739591-117739613 11:117739607-117739629
Sequence CCGAAGTCAAGCTATTTACCCAC TACCCACTAGAACCCCACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 255} {0: 1, 1: 0, 2: 1, 3: 8, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!