ID: 1089339214_1089339217

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1089339214 1089339217
Species Human (GRCh38) Human (GRCh38)
Location 11:117746249-117746271 11:117746301-117746323
Sequence CCTGGCACATAGTGCTATATAAG TGCAAATGTGTTAGGTGCCTTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 13, 3: 43, 4: 170} {0: 1, 1: 0, 2: 0, 3: 17, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!