ID: 1089433169_1089433174

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1089433169 1089433174
Species Human (GRCh38) Human (GRCh38)
Location 11:118438404-118438426 11:118438423-118438445
Sequence CCATTGGATGCAGAAGGGGGGAG GGAGTTCGAATTGTAGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 178} {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!