ID: 1089572602_1089572609

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1089572602 1089572609
Species Human (GRCh38) Human (GRCh38)
Location 11:119420360-119420382 11:119420397-119420419
Sequence CCTTCTGCCCTCGGGAGACCTGC CAGTGCCTCCTTCAAACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 214} {0: 1, 1: 0, 2: 2, 3: 14, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!