ID: 1089602524_1089602532

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1089602524 1089602532
Species Human (GRCh38) Human (GRCh38)
Location 11:119624337-119624359 11:119624362-119624384
Sequence CCAGGCAGCCGGCCTCTGCTCTG CTCTAAACACAGCTGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 440} {0: 1, 1: 0, 2: 3, 3: 29, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!