ID: 1089611223_1089611234

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1089611223 1089611234
Species Human (GRCh38) Human (GRCh38)
Location 11:119670512-119670534 11:119670553-119670575
Sequence CCTGCATGGGGCCCACTGGGACC TGACAGGAGGAGTGGTGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 225} {0: 1, 1: 0, 2: 3, 3: 68, 4: 472}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!