ID: 1089611570_1089611579

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1089611570 1089611579
Species Human (GRCh38) Human (GRCh38)
Location 11:119672337-119672359 11:119672358-119672380
Sequence CCTGGGCCTCTCCCCACCTTGTC TCATTACCCCAGAGGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 55, 4: 475} {0: 1, 1: 0, 2: 3, 3: 12, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!