ID: 1089613465_1089613472

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1089613465 1089613472
Species Human (GRCh38) Human (GRCh38)
Location 11:119682250-119682272 11:119682271-119682293
Sequence CCACCGGAAAGAAAGAAAGAGCT CTGGATGGGGGCAAGAATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 339} {0: 1, 1: 0, 2: 0, 3: 18, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!