ID: 1089695485_1089695489

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1089695485 1089695489
Species Human (GRCh38) Human (GRCh38)
Location 11:120213565-120213587 11:120213580-120213602
Sequence CCTAGGACGGGGTGGAGTTGGAG AGTTGGAGAGTGCAGTGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 250} {0: 1, 1: 0, 2: 0, 3: 30, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!