ID: 1089702884_1089702893

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1089702884 1089702893
Species Human (GRCh38) Human (GRCh38)
Location 11:120255863-120255885 11:120255901-120255923
Sequence CCTTCCTCCCTCTGGTGACCTTG GTTGTCCCTCAGCGAGACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 354} {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!