ID: 1089706702_1089706717

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1089706702 1089706717
Species Human (GRCh38) Human (GRCh38)
Location 11:120283389-120283411 11:120283439-120283461
Sequence CCAGGATGTGGCAACCCAGCAGC GGCAGGCCTCTGAGGATCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 174} {0: 1, 1: 0, 2: 3, 3: 30, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!