ID: 1089744203_1089744210

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1089744203 1089744210
Species Human (GRCh38) Human (GRCh38)
Location 11:120605719-120605741 11:120605732-120605754
Sequence CCCCTGCCCTTCAGCCACGCTGG GCCACGCTGGGCACAGAGCGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 86, 4: 1025} {0: 1, 1: 0, 2: 0, 3: 18, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!