ID: 1089752392_1089752398

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1089752392 1089752398
Species Human (GRCh38) Human (GRCh38)
Location 11:120660928-120660950 11:120660950-120660972
Sequence CCCTTGCCTTGTTGCTGTGGGAC CGCCCACTTTAGGTGTGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 222} {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!