ID: 1089763374_1089763383

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1089763374 1089763383
Species Human (GRCh38) Human (GRCh38)
Location 11:120745134-120745156 11:120745175-120745197
Sequence CCTCCAGTTTTCATCCTGGTCAC GGAGACAGAGGAGGTGACTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 176} {0: 1, 1: 1, 2: 3, 3: 54, 4: 518}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!