ID: 1089791363_1089791370

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1089791363 1089791370
Species Human (GRCh38) Human (GRCh38)
Location 11:120946970-120946992 11:120946995-120947017
Sequence CCATTTTCCCTCCATACCAACTT TCCACCTTTGGTTAACAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 460} {0: 1, 1: 0, 2: 1, 3: 5, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!