ID: 1089800695_1089800698

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1089800695 1089800698
Species Human (GRCh38) Human (GRCh38)
Location 11:121024428-121024450 11:121024445-121024467
Sequence CCTGTCTCGAGCAGCTGTGGGGA TGGGGATGGGAGACCTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134} {0: 1, 1: 0, 2: 5, 3: 35, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!