ID: 1089807724_1089807731

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1089807724 1089807731
Species Human (GRCh38) Human (GRCh38)
Location 11:121106439-121106461 11:121106482-121106504
Sequence CCACCCTCAATATGGGTCTGTAG GCCCAACCCACACTAAGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155} {0: 1, 1: 0, 2: 5, 3: 13, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!