ID: 1089861350_1089861351

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1089861350 1089861351
Species Human (GRCh38) Human (GRCh38)
Location 11:121592593-121592615 11:121592619-121592641
Sequence CCTAATTATTTCATGCGTGTTGA TTGCTTCCATAGCCATTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 170} {0: 1, 1: 0, 2: 0, 3: 8, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!