ID: 1089975634_1089975637

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1089975634 1089975637
Species Human (GRCh38) Human (GRCh38)
Location 11:122729295-122729317 11:122729310-122729332
Sequence CCCAGTTCAGCTGAGATGCCACG ATGCCACGCGGTTCTTGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97} {0: 1, 1: 0, 2: 0, 3: 4, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!