ID: 1090130319_1090130324

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1090130319 1090130324
Species Human (GRCh38) Human (GRCh38)
Location 11:124135247-124135269 11:124135270-124135292
Sequence CCCAGTAGCTGCAAGCTCAGAGA CAAGATGCTGACAGGGATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 262} {0: 1, 1: 0, 2: 2, 3: 28, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!