ID: 1090203694_1090203700

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1090203694 1090203700
Species Human (GRCh38) Human (GRCh38)
Location 11:124873427-124873449 11:124873456-124873478
Sequence CCTTCCTCCAAACCTGCTTCAAC TCGATACCTCCTCAAACTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 329} {0: 1, 1: 0, 2: 2, 3: 46, 4: 928}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!