ID: 1090339972_1090339976

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1090339972 1090339976
Species Human (GRCh38) Human (GRCh38)
Location 11:126009213-126009235 11:126009228-126009250
Sequence CCACTTCTCCTCCGCCTCCAGCT CTCCAGCTTCATTCAGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 207, 4: 1624} {0: 1, 1: 0, 2: 2, 3: 18, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!