ID: 1090389915_1090389921

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1090389915 1090389921
Species Human (GRCh38) Human (GRCh38)
Location 11:126381953-126381975 11:126381971-126381993
Sequence CCAGGCTGGTCCCGGGCCCCCTC CCCTCCCAGCCCACTCATCCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 6, 3: 50, 4: 453} {0: 1, 1: 1, 2: 1, 3: 50, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!