ID: 1090396166_1090396171

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1090396166 1090396171
Species Human (GRCh38) Human (GRCh38)
Location 11:126420037-126420059 11:126420065-126420087
Sequence CCCGTGGGTGGGCTAAGTGGACT CGAGAAAAGCACTGGGAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 57} {0: 1, 1: 0, 2: 1, 3: 23, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!