ID: 1090407685_1090407691

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1090407685 1090407691
Species Human (GRCh38) Human (GRCh38)
Location 11:126486965-126486987 11:126486994-126487016
Sequence CCACCTCCTCAACGAGCCTCATA GTAAGGACGAAAATGAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 104} {0: 1, 1: 0, 2: 3, 3: 33, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!