ID: 1090408834_1090408847

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1090408834 1090408847
Species Human (GRCh38) Human (GRCh38)
Location 11:126493747-126493769 11:126493782-126493804
Sequence CCTGCATCTTCTACTCTGCCCCC CTGGGCAAACACATGGTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 326} {0: 1, 1: 0, 2: 0, 3: 20, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!