ID: 1090409358_1090409369

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1090409358 1090409369
Species Human (GRCh38) Human (GRCh38)
Location 11:126496985-126497007 11:126497026-126497048
Sequence CCCCAGCCTGGGAATCCTGTCAG TAGCCAGAGCAGCTGCATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 238} {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!