ID: 1090710708_1090710713

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1090710708 1090710713
Species Human (GRCh38) Human (GRCh38)
Location 11:129382464-129382486 11:129382501-129382523
Sequence CCACTGCACCCAGCCGAGGCCTC GCTCGTGAACGTGCATGCTATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 40, 3: 357, 4: 2339} {0: 1, 1: 0, 2: 1, 3: 2, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!