ID: 1090792373_1090792378

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1090792373 1090792378
Species Human (GRCh38) Human (GRCh38)
Location 11:130102505-130102527 11:130102532-130102554
Sequence CCCTCTATGGCAGGCACCTTCAG CCTGCAGCCAGATTTGATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128} {0: 1, 1: 0, 2: 0, 3: 4, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!