ID: 1090801341_1090801348

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1090801341 1090801348
Species Human (GRCh38) Human (GRCh38)
Location 11:130174434-130174456 11:130174473-130174495
Sequence CCAAATCTATCTGACTCCAAATC GGCCCTCTGCTGCTTCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 26, 3: 151, 4: 879} {0: 1, 1: 0, 2: 3, 3: 46, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!