ID: 1090838528_1090838537

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1090838528 1090838537
Species Human (GRCh38) Human (GRCh38)
Location 11:130470980-130471002 11:130471016-130471038
Sequence CCAACCGGCTCACTCTCGCCGTG AGTACTCCGGCGTGTCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35} {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!