ID: 1090941602_1090941610

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1090941602 1090941610
Species Human (GRCh38) Human (GRCh38)
Location 11:131392567-131392589 11:131392607-131392629
Sequence CCTTGAGAAGGATGTGTTTTATA CAGGTTGAAGAGAGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 299} {0: 1, 1: 0, 2: 3, 3: 96, 4: 701}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!