ID: 1090977942_1090977950

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1090977942 1090977950
Species Human (GRCh38) Human (GRCh38)
Location 11:131691964-131691986 11:131691988-131692010
Sequence CCCCTCCTGGATGGGACTGCGGG AGGCGTGGGAACTGTCATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 161} {0: 1, 1: 0, 2: 1, 3: 5, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!