ID: 1090978379_1090978391

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1090978379 1090978391
Species Human (GRCh38) Human (GRCh38)
Location 11:131694999-131695021 11:131695037-131695059
Sequence CCACCAGAGGGCAGTGTTGGACG CGCCGCCGCCGGGAGGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 139} {0: 1, 1: 1, 2: 4, 3: 35, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!