ID: 1090978516_1090978517

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1090978516 1090978517
Species Human (GRCh38) Human (GRCh38)
Location 11:131695952-131695974 11:131695969-131695991
Sequence CCGCTCAAAGGACAGGGCTGGAG CTGGAGTGCATGAGAAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 330} {0: 1, 1: 0, 2: 1, 3: 34, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!