ID: 1090981203_1090981209

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1090981203 1090981209
Species Human (GRCh38) Human (GRCh38)
Location 11:131724202-131724224 11:131724229-131724251
Sequence CCAGGGCGCCTGCACCCCTCACC CTGCTTGTCTGATACGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 44, 4: 444} {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!