ID: 1090985247_1090985254

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1090985247 1090985254
Species Human (GRCh38) Human (GRCh38)
Location 11:131760764-131760786 11:131760807-131760829
Sequence CCTCAGGAAGGGTCGCCGGGGTG GAGCTAAGGAAACCTGTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 115} {0: 1, 1: 0, 2: 1, 3: 12, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!