ID: 1090996906_1090996916

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1090996906 1090996916
Species Human (GRCh38) Human (GRCh38)
Location 11:131874966-131874988 11:131874994-131875016
Sequence CCCCTTCTTGGTGCCTATTTGTA GGGCCTGATGGGGCAGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 209} {0: 1, 1: 0, 2: 4, 3: 61, 4: 553}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!