ID: 1091023420_1091023424

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1091023420 1091023424
Species Human (GRCh38) Human (GRCh38)
Location 11:132121472-132121494 11:132121522-132121544
Sequence CCCAGCTCCATTTATTTAAGTAA GTGAAAAGCTGGTTCATTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 170, 4: 1591} {0: 1, 1: 0, 2: 1, 3: 14, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!