ID: 1091045317_1091045321

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1091045317 1091045321
Species Human (GRCh38) Human (GRCh38)
Location 11:132319838-132319860 11:132319851-132319873
Sequence CCCCGAGTAGCCTAACGGGAGGC AACGGGAGGCACCCCCCAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 892} {0: 1, 1: 32, 2: 1178, 3: 2793, 4: 1981}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!