ID: 1091057383_1091057389

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1091057383 1091057389
Species Human (GRCh38) Human (GRCh38)
Location 11:132431500-132431522 11:132431517-132431539
Sequence CCACTCTGTCCTTGTGGCTCTGT CTCTGTGTGGGGAAGGCAACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 483} {0: 1, 1: 0, 2: 2, 3: 16, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!