ID: 1091147057_1091147059

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1091147057 1091147059
Species Human (GRCh38) Human (GRCh38)
Location 11:133289253-133289275 11:133289293-133289315
Sequence CCTGACTTCTCCTTCATGTTTTG TTTTAAAATTGACATATTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 323} {0: 1, 1: 0, 2: 6, 3: 66, 4: 821}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!