ID: 1091151329_1091151333

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1091151329 1091151333
Species Human (GRCh38) Human (GRCh38)
Location 11:133331023-133331045 11:133331044-133331066
Sequence CCCTCTATCTGCTTTCCAATACA CAATTGGTGTAGATAAAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 231} {0: 1, 1: 0, 2: 1, 3: 8, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!